View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_low_47 (Length: 296)
Name: NF14445_low_47
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 285
Target Start/End: Original strand, 40961366 - 40961632
Alignment:
| Q |
19 |
ttcatggtactagtagcaaagttttctgtatagttaagctctcttctagttggaatttgcgaaaactaatgctaacttatactaggtgttaaattatttt |
118 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40961366 |
ttcatgatactagtagcaaagttttctgtatagttaagctctcttctagttggaatttgcgaaaactaatgctaacttatactaggtgttaaattatttt |
40961465 |
T |
 |
| Q |
119 |
agtcttaatctgacgacaagaatatacatgattaaacatagaatgttactgtgacgcccaacttccctgctaaaggctggtgttggaggtttgatgttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40961466 |
agtcttaatctgacgacaagaatatatatgattaaacatagaatgttactgtgacgcccaacttccctgctaaaggctggtgttggaggtttgatgttct |
40961565 |
T |
 |
| Q |
219 |
tgtttcaggtaatcaggttcaaggcatttttctttcttgtgaaatataagaaataaatcaaaatatt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40961566 |
tgtttcaggtaatcaggttcaaggcatttttctttcttgtgaaatataagaaataaatcaaaatatt |
40961632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University