View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14445_low_54 (Length: 254)

Name: NF14445_low_54
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14445_low_54
NF14445_low_54
[»] chr3 (2 HSPs)
chr3 (15-60)||(11749792-11749837)
chr3 (172-223)||(47754354-47754405)


Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 60
Target Start/End: Original strand, 11749792 - 11749837
Alignment:
15 tcagttcttgggtccattttcttctgttcttgctttcccgcgtgaa 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
11749792 tcagttcttgggtccattttcttctgttcttgctttcccgcgtgaa 11749837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 172 - 223
Target Start/End: Complemental strand, 47754405 - 47754354
Alignment:
172 tttattgctgctacatcatatgcttctgctgcttcctccttggtgcctaaaa 223  Q
    |||||||||||||||||||||||||||||||||||||| |  ||||||||||    
47754405 tttattgctgctacatcatatgcttctgctgcttcctcttgagtgcctaaaa 47754354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University