View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_low_54 (Length: 254)
Name: NF14445_low_54
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 60
Target Start/End: Original strand, 11749792 - 11749837
Alignment:
| Q |
15 |
tcagttcttgggtccattttcttctgttcttgctttcccgcgtgaa |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11749792 |
tcagttcttgggtccattttcttctgttcttgctttcccgcgtgaa |
11749837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 172 - 223
Target Start/End: Complemental strand, 47754405 - 47754354
Alignment:
| Q |
172 |
tttattgctgctacatcatatgcttctgctgcttcctccttggtgcctaaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
47754405 |
tttattgctgctacatcatatgcttctgctgcttcctcttgagtgcctaaaa |
47754354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University