View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_low_56 (Length: 252)
Name: NF14445_low_56
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_low_56 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 40 - 234
Target Start/End: Complemental strand, 22309766 - 22309574
Alignment:
| Q |
40 |
aaacaaggtgtatgcttcaatttggagacgatagattaagtnnnnnnnnnctggcaatggtcattgattgtcattgaaaaaggaatttcataaacaagta |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22309766 |
aaacaaggtgtatgcttcaatttggagacgatagcttaagtaaaaaaaa-ctggcaatggtcattgattgttattgaaaaaggaatttcataaacaagta |
22309668 |
T |
 |
| Q |
140 |
tttcgtaaaatatggtgtagttatttttagtgggatccnnnnnnnaaaatcaatacaataatatattttatgtttatacatgatggcgtgcaata |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22309667 |
tttcgtaaaatatggtgtagttatttttagtgggatcc-ttttttaaaatcaatacaataatatattttatgtttatacatgatggcgtgcaata |
22309574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University