View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_low_59 (Length: 248)
Name: NF14445_low_59
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 13 - 185
Target Start/End: Original strand, 2675151 - 2675323
Alignment:
| Q |
13 |
aatataataacaaatttaaaaataccttgcttacagctccgcaacttaagttatagtaacaaatttcccttggagttcagtcaactgaagttttacctga |
112 |
Q |
| |
|
|||||| || |||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2675151 |
aatatagtagcaaatttaaaaataccttgcttacggcttcgcaacttaagttatagccacaaatttcccttggagttctgtcaactgaagttttacctga |
2675250 |
T |
 |
| Q |
113 |
tcaagatacaaagagtttaactaccaaacaattcaaataagttggctaattaaattgtaagaggaggtcaatt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
2675251 |
tcaagatacaaagagtttaactaccaaacaattcaaataagtttgctaattaaattgtaagagtaggtcaatt |
2675323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University