View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14445_low_63 (Length: 232)

Name: NF14445_low_63
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14445_low_63
NF14445_low_63
[»] chr4 (1 HSPs)
chr4 (7-216)||(17894851-17895060)
[»] chr7 (1 HSPs)
chr7 (89-205)||(9386437-9386553)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 216
Target Start/End: Complemental strand, 17895060 - 17894851
Alignment:
7 tcgaagaatattcaaatagtttcaatgaatcaacatacaaagatcaaaatctagacgaatcttacttaattgatgatgtaggcgatattgtgaagatgga 106  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
17895060 tcgacgaaaattcaaatagtttcaatgaatcaacatacaaagatcaaaatctagacgaatcttacttaattgatgatgtaggcgatattgtgaagatgga 17894961  T
107 tgtgtttaacttgaaaaatgaagatgtttcaaagttataatttgttaatcttgaagttgcgtacaagttttacttttggtttgcaaagatgaatggttta 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
17894960 tgtgtttaacttgaaaaatgaagatgtttcaaagttataatttgttaatcttgaagttgcgtacaagttttactcttggtttgcaaagatgaatggttta 17894861  T
207 gccatccaca 216  Q
    ||||||||||    
17894860 gccatccaca 17894851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 89 - 205
Target Start/End: Original strand, 9386437 - 9386553
Alignment:
89 cgatattgtgaagatggatgtgtttaacttgaaaaatgaagatgtttcaaagttataatttgttaatcttgaagttgcgtacaagttttacttttggttt 188  Q
    ||||||||| |||||| || ||||||| ||| |||||||||||||||||||| ||  |||||  | | |||| ||||| ||||| ||||| | ||||||     
9386437 cgatattgtaaagatgtatatgtttaatttgcaaaatgaagatgtttcaaagctactatttgggagtgttgaggttgcctacaatttttattgttggttc 9386536  T
189 gcaaagatgaatggttt 205  Q
    ||||||||||| |||||    
9386537 gcaaagatgaacggttt 9386553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University