View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14445_low_67 (Length: 201)
Name: NF14445_low_67
Description: NF14445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14445_low_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 14 - 179
Target Start/End: Original strand, 46756189 - 46756354
Alignment:
| Q |
14 |
atatcaactataagtgaaactcgacttaattggaaatacataatatagctttatttcttcgtttattatttatgcatataaccgagttgtgtactgtaaa |
113 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46756189 |
atatcaactataagtgaaacttgacttaattggaaatacataatatagctttatttcttcgtttattatttatgcatataactgagttgtgtactgtaaa |
46756288 |
T |
 |
| Q |
114 |
atacatgttactattatattatttgggtttaaatttaataagtcgttctctaaatttatggggtga |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46756289 |
atacatgttactattatattatttgggtttaaatttaataagtcgttctctaaatttatggggtga |
46756354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University