View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14446_low_7 (Length: 367)
Name: NF14446_low_7
Description: NF14446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14446_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 13 - 170
Target Start/End: Complemental strand, 11149847 - 11149690
Alignment:
| Q |
13 |
aatatatttggtggtgaatttgatttggtctattgtaggggaaccgtagaactcagaaaattgcttgagaaagtctcacaatttgtgaaatatacacgta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11149847 |
aatatatttggtggtgaatttgatttggtctattgtaggggaaccgtagaactcagaaaattgcttgagaaagtctcacaatttgtgaaatatacacgta |
11149748 |
T |
 |
| Q |
113 |
tataaaaaagtgatgaggaagacattcatagcgttgtaagtatacctcatattgtaag |
170 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11149747 |
tatgaaaaagtgatgaggaagacattcatagcgttgtaagtatacctcatattgtaag |
11149690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 262 - 321
Target Start/End: Complemental strand, 11149366 - 11149307
Alignment:
| Q |
262 |
gacggaatgatgtcggggaatcagaacatgtgccaccgtaagtaaaccacattaatcttg |
321 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11149366 |
gacggaatgacgtcggggaatcaaaacatgtgccaccgtaagtacaccacattaatcttg |
11149307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University