View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14447_low_14 (Length: 267)
Name: NF14447_low_14
Description: NF14447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14447_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 6855168 - 6855404
Alignment:
| Q |
13 |
cagataaaacaccaccatatgcaaattttacaatccttctgcttctaggtaactttgatctcttgtactctgtgggccttaaacatggaatcccccctta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855168 |
cagataaaacaccaccatatgcaaattttacaatccttctgcttctaggtaactttgatctcttgtactctgtgggccttaaacatggaatcccccctta |
6855267 |
T |
|
| Q |
113 |
tgaaccctctttccattaacaatgcattttggtccactagctctcttcctagttgtcggtaaacaagcttcccatcaagggttttgacaacccggactgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6855268 |
tgaaccctctttccattaacaatgcattttggtccactagctctcttcctagttgtcggtaaacaagcttcccatcgagggttttgacaacccggactgt |
6855367 |
T |
|
| Q |
213 |
atataactacatttccaccatacttattcccaccaac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6855368 |
atataactacatttccaccatacttattcccaccaac |
6855404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 182
Target Start/End: Complemental strand, 24242532 - 24242462
Alignment:
| Q |
113 |
tgaaccctctttccattaacaatgcattttggtccactagctctcttcctagttgtc-ggtaaacaagctt |
182 |
Q |
| |
|
|||| |||||||||| ||||| |||||| |||||||||||||||||| | |||||| | ||||||||||| |
|
|
| T |
24242532 |
tgaatcctctttccagtaacagggcatttaggtccactagctctcttcttggttgtctgataaacaagctt |
24242462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 93
Target Start/End: Complemental strand, 24245048 - 24244968
Alignment:
| Q |
13 |
cagataaaacaccaccatatgcaaattttacaatccttctgcttctaggtaactttgatctcttgtactctgtgggcctta |
93 |
Q |
| |
|
|||||||||| |||||||| ||| || ||| |||| ||| ||||||||||| | |||||||||||||| ||||| |||| |
|
|
| T |
24245048 |
cagataaaactccaccataggcacgattcacagtcctcctgtttctaggtaacctagatctcttgtactcagtgggtctta |
24244968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University