View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1444_high_9 (Length: 287)
Name: NF1444_high_9
Description: NF1444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1444_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 13 - 180
Target Start/End: Original strand, 37888371 - 37888538
Alignment:
| Q |
13 |
aaaattataaatcaatggttgatgatatagaatggagttataccagaaaataagattaggaaatgaagaaaaacatatatttcatattccaacatgtttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37888371 |
aaaattataaatcaatggttgatgatatagaatggagttataccagaaaataagattaggaaatgaagaaaaacatatatttcatattccaacatgtttc |
37888470 |
T |
 |
| Q |
113 |
tcgttacttgtatcgtgctaaacacttaatagcagatttgttgttaaattacttttcatcctaaaaag |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37888471 |
tcgttacttgtatcgtgctaaacacttaatagcagatttgttgttaaattacttttcatcctaaaaag |
37888538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University