View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1444_low_16 (Length: 235)
Name: NF1444_low_16
Description: NF1444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1444_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 45 - 219
Target Start/End: Complemental strand, 5378660 - 5378485
Alignment:
| Q |
45 |
taaaaaataagaaggaaaatgctaaaagatgcccttgtgacattggttaagaggatacnnnnnnn-ggtgttaggctaatgctcactctggctactaaaa |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5378660 |
taaaaaataagaaggaaaatgctaaagaatgcccttgtgacattggttaagaggatacaaaaaaaaggtgttaggctaatgctcactctggctactaaaa |
5378561 |
T |
 |
| Q |
144 |
ccttaacctggaagtgtcacaaattcaatctaaacaaaatatgcagtagtagaaaacacactaaaaggcacactat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5378560 |
ccttaacctggaagtgtcacaaattcaatctaaacaaaatatgcagtagtagaaaacacactaaaaggcacactat |
5378485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University