View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14451_high_22 (Length: 318)
Name: NF14451_high_22
Description: NF14451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14451_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 313
Target Start/End: Original strand, 25577292 - 25577587
Alignment:
| Q |
19 |
tatggggcacgattcacctcaatcaaataaactggatttatctatttacacatctgagtacttggttctgattgtcgtgtgcaattgatgtggtatatgg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25577292 |
tatggggcacgattcacctcaatcaaataaactggatttatctatttacacatctgagtacatggttctgattgtcatgtgcaattgatgtggtatatgg |
25577391 |
T |
 |
| Q |
119 |
ggtgcctaagtctcaaatcgagtagtatgtgatgcttggtggagtgtggaatggttcctctcccttgacagctactcctgctgtttctttttagatgtcg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25577392 |
ggtgcctaagtctcaaatcgagtagtatgtgatgctcagtggagtgtggaatggttcctctcccttgacagctactcctgctgtttctttttagatgtcg |
25577491 |
T |
 |
| Q |
219 |
ttttagaactttttaaacatttcaagacacttttgagaaaattattaatc-tatagttttactatttttgataaaattatttatcttttccctatg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25577492 |
ttttagaactttttaaacatttcaagacacttttgataaaattattaatcttatagttttactatttttgataaaattattaatcttttctctatg |
25577587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University