View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14451_high_24 (Length: 296)
Name: NF14451_high_24
Description: NF14451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14451_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 280
Target Start/End: Original strand, 50601550 - 50601817
Alignment:
| Q |
13 |
ctttcacttttatttcctctaaaccgtctaattgaataatagttttcctaaacttttaggtccccaattttagtcccattgttaactacccttaatgtaa |
112 |
Q |
| |
|
|||||||||||| | ||||||| ||| ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
50601550 |
ctttcacttttagtctctctaaaacgtttaattgaataatagtcttcctaaacttttaagtccccaattttagtcccattgttaattacccttaacgtaa |
50601649 |
T |
 |
| Q |
113 |
gatgcatgatctatgttggataaataggaccttgtcttacttggttcgaagaatgatagcatgactatctatatggttggaaaggaatcggtatcaatgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50601650 |
gatgcatgatctatgttggataaataggaccttgtcttacttggttcgaagaatgataacatgactatctatatggttggaaaggaatcggtatcaatgg |
50601749 |
T |
 |
| Q |
213 |
acatttccaaaactcccttattcactaactaaaacatgcattgcttaattgccatttgagtggctctt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
50601750 |
acatttccaaaactcccttattcactaactaaagcatgcattgcttaattgccttttgagtggctctt |
50601817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University