View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14451_high_26 (Length: 273)
Name: NF14451_high_26
Description: NF14451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14451_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 30 - 261
Target Start/End: Original strand, 28346759 - 28346990
Alignment:
| Q |
30 |
taaaattaatatatcttattatttcttaaacttcttgattatatggtgtgtaccgttggaaatgtatttttctttaataaatcatactttttcacttgtc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28346759 |
taaaattaatatatcttattatttcttaaacttcttgattatatggtgtgtgccgttggaaatgtatttttctttaataaatcatactttttcacttgtc |
28346858 |
T |
 |
| Q |
130 |
cccctaaacataaactctggctttgtctcttcttgtgatgttcaacaacacaaaacaacgttagtctcatatgtgtcaagccaatttagccaaatgcatg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28346859 |
cccctaaacataaactctggctttgtctcttcttgtgatgttcaacaacacaaaacaacattagtctcatatgtgtcaagccaatttagccaaatgcatg |
28346958 |
T |
 |
| Q |
230 |
acttcacttgatcaagaatttttctttttgat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28346959 |
acttcacttgatcaagaatttttctttttgat |
28346990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 28346356 - 28346393
Alignment:
| Q |
1 |
aatttctttttatatttgtttaacggtattaaaattaa |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28346356 |
aatttctttttatatttgtttaacggtattaaaattaa |
28346393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University