View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14451_low_10 (Length: 482)
Name: NF14451_low_10
Description: NF14451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14451_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-153; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 169 - 461
Target Start/End: Complemental strand, 21484600 - 21484311
Alignment:
| Q |
169 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggctgttttga |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484600 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggctgttttga |
21484501 |
T |
|
| Q |
269 |
aatcagatgttgaagtagatcatcaaggttatcatcaaaaacatggtcatccattagattatcatcatggtcatcctccaacaactttgtcatcaactgc |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484500 |
aatcagatgttgaagtagatcatcaaggttatca---aaaacatggtcatccattagattatcatcatggtcatcctccaacaactttgtcatcaactgc |
21484404 |
T |
|
| Q |
369 |
ttctatggagatttctcagcaacagcaacaagatcttggtgtttctaacaatgatgttgttgttggtggtggtgattgcatggatgatgttaa |
461 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21484403 |
ttctatggagatttctcaacaacagcaacaagatcttggtgtttctaacaatgatgttgttgttggtggtggtgattgcatggatgatgttaa |
21484311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 32 - 138
Target Start/End: Complemental strand, 21484737 - 21484631
Alignment:
| Q |
32 |
ataatactacaaatgatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttccacctttacctgattttcc |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21484737 |
ataatactacaaatgatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttcctcctttacctgattttcc |
21484638 |
T |
|
| Q |
132 |
atgcatg |
138 |
Q |
| |
|
||||||| |
|
|
| T |
21484637 |
atgcatg |
21484631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University