View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14451_low_29 (Length: 265)
Name: NF14451_low_29
Description: NF14451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14451_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 15 - 143
Target Start/End: Original strand, 37492422 - 37492550
Alignment:
| Q |
15 |
atgaataatagatgaatcacataatgaaattgtacagattcatttccaataatctttattgaaaaacaaagtattgaattagttgatcatcaatattaga |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492422 |
atgaataatagatgaatcacattatgaaattgtacatattcatttccaataatctctattgaaaaacaaagtattgaattagttgatcatcaatattaga |
37492521 |
T |
 |
| Q |
115 |
tgaatgtaaatatacaatggtcctcatag |
143 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
37492522 |
tgaatgtaaatatacaatggtactcatag |
37492550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 225 - 265
Target Start/End: Original strand, 37492732 - 37492772
Alignment:
| Q |
225 |
gggacaaccaaaattcattttatataggaattaaactccat |
265 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
37492732 |
gggacaaccaaaattcattttatattggaaataaactccat |
37492772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University