View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14451_low_36 (Length: 228)
Name: NF14451_low_36
Description: NF14451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14451_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 6178174 - 6177977
Alignment:
| Q |
19 |
catgcgcaccttgagaaccacctaatagattggtaaaagaatttattgcattcaattgctggtgctgcaacaagtcttcgccgtgcattggcttcacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6178174 |
catgcgcaccttgagaaccacctaatagattggtaaaagaatttattgcattcaattgctggtgctgcaacaagtcttcgccgtgcattggcttcacaaa |
6178075 |
T |
|
| Q |
119 |
tcaagagaaaacatgtaacaaggactaacattatagacattccagtttgtaggattcacttacctctgaagatcgttgaagacgttctttctgtgctg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6178074 |
tcaagagaaaacatgtaacaaggactaacattataaacattccagtttgtaggattcgcttacctctgaagatcgttgaagacgttctttctgtgctg |
6177977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University