View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14451_low_40 (Length: 210)
Name: NF14451_low_40
Description: NF14451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14451_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 129 - 194
Target Start/End: Original strand, 14891631 - 14891696
Alignment:
| Q |
129 |
tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtcttattgacgccgttgc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14891631 |
tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgc |
14891696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 14 - 59
Target Start/End: Original strand, 14891521 - 14891566
Alignment:
| Q |
14 |
gcttctccacaaaaacgctcactctcctactccataaggtaaatca |
59 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14891521 |
gcttccccacaaaaacgcttactctcctactccataaggtaaatca |
14891566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University