View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14451_low_40 (Length: 210)

Name: NF14451_low_40
Description: NF14451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14451_low_40
NF14451_low_40
[»] chr5 (2 HSPs)
chr5 (129-194)||(14891631-14891696)
chr5 (14-59)||(14891521-14891566)


Alignment Details
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 129 - 194
Target Start/End: Original strand, 14891631 - 14891696
Alignment:
129 tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtcttattgacgccgttgc 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
14891631 tatgatggttgtattttaggtttccggtgcaattggctggtacacaggtctcattgacgccgttgc 14891696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 14 - 59
Target Start/End: Original strand, 14891521 - 14891566
Alignment:
14 gcttctccacaaaaacgctcactctcctactccataaggtaaatca 59  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||    
14891521 gcttccccacaaaaacgcttactctcctactccataaggtaaatca 14891566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University