View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14451_low_41 (Length: 203)
Name: NF14451_low_41
Description: NF14451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14451_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 185
Target Start/End: Original strand, 27443091 - 27443263
Alignment:
| Q |
13 |
agatgaactttgagaaacaaatatgaaaactgaatttctgattcaatataacgtgaattgtacaagcacgaaatattcacttgagcagtatcagctcatc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27443091 |
agatgaactttgagaaacaaatatgaaaactgaatttctgattcaatataaggtgaattgtacaagcacgaaatattcacttgagcattatcagctcatc |
27443190 |
T |
|
| Q |
113 |
attactgtcataactaactaaataagcacgaaatgaaattgaaattacaaatgtaactcaactagtaatgtgt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27443191 |
attactgtcataactaactaaataagcacgaaatgaaattgaaattacaaatgtaactcaactagtaatgtgt |
27443263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 165
Target Start/End: Original strand, 25079546 - 25079606
Alignment:
| Q |
105 |
agctcatcattactgtcataactaactaaataagcacgaaatgaaattgaaattacaaatg |
165 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| ||| |||||||||| |||| || |||||| |
|
|
| T |
25079546 |
agctcatcataactgtgataactaactaaatgagcgcgaaatgaaactgaattttcaaatg |
25079606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University