View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14452_low_1 (Length: 397)
Name: NF14452_low_1
Description: NF14452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14452_low_1 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 174 - 397
Target Start/End: Complemental strand, 22270149 - 22269926
Alignment:
| Q |
174 |
gttcaagaaagcactccgattccaaatctcgcttcgaagcttacaaccgcctccaagccgccgctgtcgctttcggcgagactctccccatccctgaaat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22270149 |
gttcaagaaagcactccgattccaaatctcgcttcgaagcttacaaccgcctccaagccgccgctgtcgctttcggcgagactctccccatccctgaaat |
22270050 |
T |
 |
| Q |
274 |
tgttgccgttggtggccaatctgatggaaagagctcccttctcgaagcactcctcggttttcgcttcaatgtccgtgaagttgagatgggtactcgccgc |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22270049 |
tgttgccgttggtggccaatctgatggaaagagctcccttctcgaagcactcctcggttttcgcttcaatgtccgtgaagttgagatgggtactcgccgc |
22269950 |
T |
 |
| Q |
374 |
cctcttattcttcaaatgcttcac |
397 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
22269949 |
cctcttattcttcaaatgcttcac |
22269926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 12 - 76
Target Start/End: Complemental strand, 22270316 - 22270252
Alignment:
| Q |
12 |
agcataggaacgttaacccaaaattcaaattcaaatttcatttgcatcgctcccctccttttccc |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22270316 |
agcataggaacgttaacccaaaattcaaattcaaatttcattttgatcgctcccctccttttccc |
22270252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University