View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14453_high_6 (Length: 224)
Name: NF14453_high_6
Description: NF14453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14453_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 98 - 206
Target Start/End: Original strand, 34097429 - 34097544
Alignment:
| Q |
98 |
acagtaactggatctgcaaaacaacagtggta-------gtgatgttatatgagaaaaatggatttatccaaagtgaattttctactaaagtgcaaacct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34097429 |
acagtaactggatctgcaaaacaacagtggtagacggtagtgatgttatatgagaaaaatggatttatccaaagtgaattttctactaaagtgcaaacct |
34097528 |
T |
|
| Q |
191 |
acacctataatggttc |
206 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34097529 |
acacctataatggttc |
34097544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University