View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14453_low_5 (Length: 289)
Name: NF14453_low_5
Description: NF14453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14453_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 103 - 280
Target Start/End: Complemental strand, 30412090 - 30411913
Alignment:
| Q |
103 |
gaggttgttatgatttgtaaaaaattgagagactaaatggttaaatttcctttaaataaggataaggttgttttgaaagagagataacgccnnnnnnnnn |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30412090 |
gaggttgttatgatttgtaaaaaattgagagactaaatggttaaatttcctttaaataaggataaggttgttttgaaagagagataacgccttttttttc |
30411991 |
T |
 |
| Q |
203 |
nnnnnnnnnnagtgaaattaattaaaccgaaatttgcttagtctctcctcatatagaacaccacgtacatatgcatat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30411990 |
cttttcttttagtgaaattaattaaaccgaaatttgcttagtctctcctcatatagaacaccacgtacacatgcatat |
30411913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University