View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14453_low_6 (Length: 262)
Name: NF14453_low_6
Description: NF14453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14453_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 48 - 247
Target Start/End: Original strand, 5033505 - 5033709
Alignment:
| Q |
48 |
aagactatttcttcttgtatgagctgagaattgttttagctaatcactaggttaaggttgaaattatctgacacttagccatacgagtctctcatagact |
147 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5033505 |
aagactatttcttcttgtatgagctaagaattgttttagctaatcactaggttaaggttgaaattatctgacacttggccatacgagtctctcatagaca |
5033604 |
T |
 |
| Q |
148 |
agttttctacaacagattttaactacataaactaaatttcacctttt-atatgca----cctttttcatggcaatgacacattgatttttatgagttgca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033605 |
agttttctacaacagattttaactacataaactaaatttcaccttttaatatgcaattctatttttcatggcaatgacacattgatttttatgagttgca |
5033704 |
T |
 |
| Q |
243 |
attaa |
247 |
Q |
| |
|
||||| |
|
|
| T |
5033705 |
attaa |
5033709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 60
Target Start/End: Original strand, 5033440 - 5033487
Alignment:
| Q |
13 |
gagaaagtttagtaatgtctcgcagcatgagtataaagactatttctt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033440 |
gagaaagtttagtaatgtctcgcagcatgagtataaagactatttctt |
5033487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 5026413 - 5026368
Alignment:
| Q |
150 |
ttttctacaacagattttaactacataaactaaatttcacctttta |
195 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
5026413 |
ttttctacaacagatgttaattacataaaataaatttcacctttta |
5026368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University