View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14453_low_8 (Length: 232)
Name: NF14453_low_8
Description: NF14453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14453_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 179 - 216
Target Start/End: Original strand, 15032796 - 15032833
Alignment:
| Q |
179 |
agaagaatgcttgccttgtctcattgatggagagaaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15032796 |
agaagaatgcttgccttgtctcattgatggagagaaaa |
15032833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University