View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14454_low_4 (Length: 286)
Name: NF14454_low_4
Description: NF14454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14454_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 10393261 - 10392995
Alignment:
| Q |
1 |
acctcttcagcttggtcttcttttcctcctctttcaagtaacccttttatctctacctctttttattctatcttacatgcattttaatcaagtgggttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10393261 |
acctcttcagcttggtcttcttttcctcctctttcaagtaacccttttatctctacctctttttattctatcttacatgcattttaatcaagtgggttga |
10393162 |
T |
 |
| Q |
101 |
atcaaaatcctatcnnnnnnngttagttgttggttttgtcataaatagggaataccctttttgcaatttgatatgtattgttgttaggccttaggatagg |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10393161 |
atcaaaatcctatctttttttgttagttgttggttttgtcataaat-gggaataccctttttggaatttgatatgtattgttgttaggccttaggatagg |
10393063 |
T |
 |
| Q |
201 |
attagttagttggttatgatgttgaaacttg-aaaattgttttggcattggtttttaatgtatggtct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10393062 |
attagttagttggttatgatgttgaaacttgaaaaattgttttggcattggtttttaatgtatggtct |
10392995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 30844133 - 30844090
Alignment:
| Q |
1 |
acctcttcagcttggtcttcttttcctcctctttcaagtaaccc |
44 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30844133 |
acctcttcagcttggtcctcttttcctcctctttcaagtaaccc |
30844090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University