View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14454_low_7 (Length: 208)
Name: NF14454_low_7
Description: NF14454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14454_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 39591483 - 39591663
Alignment:
| Q |
20 |
gtattaaggtcccccatctgggtaccaaatgtccttctactaagccttctgagcacattcagtgatctatgaagctcatcaagggcatctgcaatagtct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39591483 |
gtattaaggtcccccatctgggtaccaaatgtccttctactaagccttctgagcacattcagtgatctatgaagctcatcaagggcatctgcaatagtct |
39591582 |
T |
 |
| Q |
120 |
cgacacaatctaatagtgcaactttatttcttcctcttaaacgcccgtgtctagttaagtttgcgagatattcttcgacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||| |
|
|
| T |
39591583 |
cgacacaatctaatagtgcaactttatttcttcctcttaaacgcccgtgtctagttaagtttgtgagatatgcttggacat |
39591663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University