View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14455_high_14 (Length: 224)
Name: NF14455_high_14
Description: NF14455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14455_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 85 - 171
Target Start/End: Complemental strand, 25419141 - 25419055
Alignment:
| Q |
85 |
aaatctaataacaataagatagataaccacaaataaagttcagattcaaaattacatgacnnnnnnnctaaatgtaacagcaaacaa |
171 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25419141 |
aaatctaataacaattagatagataaccacaactaaagttcagattcaaaattacatgacaaaaaaactaaatgtaacagcaaacaa |
25419055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 25420770 - 25420708
Alignment:
| Q |
7 |
aatcaaagttacatgacaaaataaccaaatgcaacacaaatatgaaataagcttaacatagat |
69 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25420770 |
aatcaaaattacatgacaaaataaccaaatgcaacacaaatatgaaataagcttaatatagat |
25420708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 173 - 224
Target Start/End: Complemental strand, 25418252 - 25418201
Alignment:
| Q |
173 |
taaatctcaaatgaaatgccaataattaactttaactctcctttaataggtt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25418252 |
taaatctcaaatgaaatgccaataattaactttcactctcctttaataggtt |
25418201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University