View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14455_high_16 (Length: 216)

Name: NF14455_high_16
Description: NF14455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14455_high_16
NF14455_high_16
[»] chr7 (2 HSPs)
chr7 (1-53)||(42292830-42292882)
chr7 (140-172)||(42292911-42292943)


Alignment Details
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 42292830 - 42292882
Alignment:
1 cttgttgatgtcgtttttacagggcatgttcatgcctacgaacgctttgtaag 53  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||    
42292830 cttgttgatgtcgtttttacagggcatgttcatgcatacgaacgctttgtaag 42292882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 172
Target Start/End: Original strand, 42292911 - 42292943
Alignment:
140 tctagttgaagtactggttcaatcgggttgaaa 172  Q
    |||||||||||| ||||||||||||||||||||    
42292911 tctagttgaagtgctggttcaatcgggttgaaa 42292943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University