View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14455_high_4 (Length: 395)
Name: NF14455_high_4
Description: NF14455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14455_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 48565212 - 48565444
Alignment:
| Q |
14 |
cataggaaagcaaatgcataccgattcacttggtagtttaataaaattattttttgttagttcatattgatttacattatcttgcggtgcaaacttataa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565212 |
cataggaaagcaaatgcataccgattcacttggtagtttaataaaattattttttgttagttcatattgatttacattatcttgcggtgcaaacttataa |
48565311 |
T |
|
| Q |
114 |
aaactaaacatttgatgacttctgcatgctaactaacataagtctttttcatttaatctgagttatttaaataccgctagtgaatttccgagatttctac |
213 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48565312 |
aaactaaacatttgatgacttctacatgctaactaacataagtc-ttttcatttaatctgag----ttaaataccgctagtgaatttccgagatttctac |
48565406 |
T |
|
| Q |
214 |
agtctagtctaaccatgatgaccaaaggcttattctat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565407 |
agtctagtctaaccatgatgaccaaaggcttattctat |
48565444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 263 - 323
Target Start/End: Original strand, 48565488 - 48565548
Alignment:
| Q |
263 |
tgagggatgggaaattgaatcatcatatttgaagtgtgtgcaatctccctcttttttctct |
323 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565488 |
tgaggtatgggaaattgaatcatcatatttgaagtgtgtgcaatctccctcttttttctct |
48565548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University