View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14455_high_7 (Length: 308)
Name: NF14455_high_7
Description: NF14455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14455_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 15 - 204
Target Start/End: Original strand, 11144510 - 11144698
Alignment:
| Q |
15 |
aaaaatttagttcaatattgtatgaatgtgagaaaaaggtttgaaattttgacacatgttagtaaaaatctcatgcaagtttacacaaatgtnnnnnnnn |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11144510 |
aaaaatttagttcaatattgtatgaatgtgagaaaaaggtttgaaattttgacacatgttagt-aaaatctcatgcaagtttacacaaatgtaaaaaaaa |
11144608 |
T |
 |
| Q |
115 |
nnnnnnnnntagagatgtgaaattgtggcaagtatctttagactaagatttttaagagtttatagctagataaataggtagaagatttgt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11144609 |
ggacaaaaatagagatgtgaaattgtggcaagtatctttagactaagatttttaagagtttatagctagataaataggtagaagatttgt |
11144698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University