View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14455_low_10 (Length: 284)
Name: NF14455_low_10
Description: NF14455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14455_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 128 - 263
Target Start/End: Complemental strand, 5235337 - 5235199
Alignment:
| Q |
128 |
ctctcatggatacatagcgcaaagtgaaacatataacataaccaaatcaacnnnnnnnn---gttgagagaagagtttgtttcgttttcctaatgtgctc |
224 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5235337 |
ctctcttggatacatagcgcaaagtcaaacatataacataaccaaatcaactttttttttttgttgagagaagagtttgtttcgttttcctaatgtgctc |
5235238 |
T |
|
| Q |
225 |
aactttttgtcttataccatactcctattttactttccc |
263 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5235237 |
aactttttgtcttatactatactcctattttactttccc |
5235199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 18 - 92
Target Start/End: Complemental strand, 5236016 - 5235938
Alignment:
| Q |
18 |
ccaaattcatattcagtcaaagtcatgtatg----gttcaaaacttgtttcacaattcttgctttgagattactgtgtt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5236016 |
ccaaattcatattcagtcaaagtcatgtatgtatggttcaaaacttgtttcacaattcttgctttgagattactgtgtt |
5235938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 40086944 - 40086991
Alignment:
| Q |
24 |
tcatattcagtcaaagtcatgtatggttcaaaacttgtttcacaattc |
71 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||| |||||| |
|
|
| T |
40086944 |
tcatattcagtcaaagtcatgtatatttcaaagcttgtttcgcaattc |
40086991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University