View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14455_low_12 (Length: 256)
Name: NF14455_low_12
Description: NF14455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14455_low_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 3 - 256
Target Start/End: Complemental strand, 42292892 - 42292639
Alignment:
| Q |
3 |
aataaaaatacttacatagcgatcgtaggcatgtacatgcactgtaaaaacgacatcaacaagtgcattatagagcaaaccttccattgcagtcttcatg |
102 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42292892 |
aataaaaatacttacaaagcgttcgtatgcatgaacatgccctgtaaaaacgacatcaacaagtgcattatagagcaaaccttccattgcagtcttcatg |
42292793 |
T |
 |
| Q |
103 |
tcaacagattcagcctcaccctgatgagcttgattagaattataccaaggagcatgaaccaacaccactacccaaggagtttttcccctgttaaccttct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42292792 |
tcaacagattcagcctcaccctgatgagcttgattagaattataccaaggagcatgaaccaacaccactacccaaggagtttttcccctgttaatcttct |
42292693 |
T |
 |
| Q |
203 |
gtaaatccccttgaagccatttgtattgtgaagaatccggtgcaaaatcggtat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42292692 |
gtaaatccccttgaagccatttgtattgtgaagaatccggtgcaaaatcggtat |
42292639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University