View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14455_low_18 (Length: 216)
Name: NF14455_low_18
Description: NF14455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14455_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 42292830 - 42292882
Alignment:
| Q |
1 |
cttgttgatgtcgtttttacagggcatgttcatgcctacgaacgctttgtaag |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42292830 |
cttgttgatgtcgtttttacagggcatgttcatgcatacgaacgctttgtaag |
42292882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 172
Target Start/End: Original strand, 42292911 - 42292943
Alignment:
| Q |
140 |
tctagttgaagtactggttcaatcgggttgaaa |
172 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
42292911 |
tctagttgaagtgctggttcaatcgggttgaaa |
42292943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University