View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14455_low_7 (Length: 320)

Name: NF14455_low_7
Description: NF14455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14455_low_7
NF14455_low_7
[»] chr4 (2 HSPs)
chr4 (1-149)||(43113686-43113834)
chr4 (239-296)||(43113924-43113981)


Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 43113686 - 43113834
Alignment:
1 tacacattcatagttgttcttacctcaacaacaaaatgtactgtttcatttgcgtccgtattagaaagaaaaataactgtggaagaagagagaatcttca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43113686 tacacattcatagttgttcttacctcaacaacaaaatgtactgtttcatttgcgtccgtattagaaagaaaaataactgtggaagaagagagaatcttca 43113785  T
101 gttcaaattttaatattattatatctaataaaaaatagtactattgatg 149  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
43113786 gttcaaattttaatattattatatctaataaaaaatagtactattgatg 43113834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 239 - 296
Target Start/End: Original strand, 43113924 - 43113981
Alignment:
239 ccacgttgaatggagtaagcgtagaaaatgggtcgtggaaaaactcgaaatttgaatg 296  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
43113924 ccacgttgaatggagtaagcgtagaaaatgggtcgtggaaaaactcaaaatttgaatg 43113981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University