View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14455_low_9 (Length: 303)
Name: NF14455_low_9
Description: NF14455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14455_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 14 - 231
Target Start/End: Original strand, 43366624 - 43366838
Alignment:
| Q |
14 |
agaagcaaagggaagatattagcaacataacaaaaaatgcatnnnnnnngaaggtgagaacattgtttgattaccggaatgtgaaatggggattgctgat |
113 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43366624 |
agaaacaaaaggaagatattagcaacataacaaaaaatgaataaaaa---aaggtgagaacattgtttgattaccggaatgtgaaatggggattgctgat |
43366720 |
T |
|
| Q |
114 |
gagaatctaaacgagatttaaccaaatcattatcctgaaatacaatcaaagttacacacagcagcagaatggaatgaggaatgtaattgaagtagaagga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43366721 |
gagaatctaaacgagatttaaccaaatcattatcctgaaatacaatcaaagttacacacagcagcaaaatggaatgaggaatgtaattgaagtagaagga |
43366820 |
T |
|
| Q |
214 |
tgaagagcatttacaata |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43366821 |
tgaagagcatttacaata |
43366838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University