View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14456_high_7 (Length: 262)
Name: NF14456_high_7
Description: NF14456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14456_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 21602695 - 21602925
Alignment:
| Q |
18 |
caaagatggaaaactgtgtatgcagccgttaaacagtttggtggatttgtcaaagatacaaacattggtgaggaagctgcagcgttgaaggacagtattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21602695 |
caaagatggaaaactgtgtatgcagccgttaaacagtttggtggatttgtcaaagatacaaacattggtgaggaagctgcagcgttgaaggacagtattg |
21602794 |
T |
 |
| Q |
118 |
ccggtactaagtggtcttctgctattgaacaaagccgtagagctggtcatgcttcggtttactctgtggctcagtacaatgccccttttgaatacgataa |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21602795 |
ccggtactaaatggtcttctgctattgaacaaagccgtagagctggtcatgcttcggtttactctgtggctcagtacaatgccccttttgaatacgataa |
21602894 |
T |
 |
| Q |
218 |
tagggtgaatgagatatggttcttgtttgat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21602895 |
tagggtgaatgagatatggttcttgtttgat |
21602925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University