View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14456_low_14 (Length: 221)
Name: NF14456_low_14
Description: NF14456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14456_low_14 |
 |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
| [»] scaffold0280 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0148 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 28345 - 28548
Alignment:
| Q |
1 |
attcattccaagtaggaatgtgtcagttggattttcaaagctctcccacagtttcacttccatgagttcatcgtcatataacacaaggttaccagaatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28345 |
attcattccaagtaggaatgtgtcagttggattttcaaagctctcccacagtttcacttccatgagttcatcgtcatataaaacaaggttaccagaatcc |
28444 |
T |
 |
| Q |
101 |
atgagtttcactgtcctgtttttaggtgaaaaactagaagagtctttgattttggaattggaattagaaaaccagtaccttttttcattaccagatgtgt |
200 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28445 |
atgagtttcactgttctgattttaggtgaaaaactagaagagtctttgattttggaactggaattagaaaaccagtaccttttttcattaccggatgtgt |
28544 |
T |
 |
| Q |
201 |
ctaa |
204 |
Q |
| |
|
|||| |
|
|
| T |
28545 |
ctaa |
28548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 76 - 128
Target Start/End: Original strand, 3615 - 3667
Alignment:
| Q |
76 |
atataacacaaggttaccagaatccatgagtttcactgtcctgtttttaggtg |
128 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3615 |
atataacacaagattaccagaatccatgagtttcaccgtcctgtttttaggtg |
3667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University