View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14456_low_7 (Length: 390)

Name: NF14456_low_7
Description: NF14456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14456_low_7
NF14456_low_7
[»] chr8 (1 HSPs)
chr8 (17-52)||(44943712-44943747)


Alignment Details
Target: chr8 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 44943747 - 44943712
Alignment:
17 tgatgtatattcgtagtaatatcagttttggcgatc 52  Q
    ||||||||||||||||||||||||||||||||||||    
44943747 tgatgtatattcgtagtaatatcagttttggcgatc 44943712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University