View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14457_high_1 (Length: 308)
Name: NF14457_high_1
Description: NF14457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14457_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 70 - 294
Target Start/End: Complemental strand, 15676614 - 15676390
Alignment:
| Q |
70 |
tggatatatttcgatgaaaaaacattcacttgagagggaccatattcaaatgaatgaatttgctcaaacttaagtgaaaaattgttggtatatcaagtgt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| || ||||||||||||| |
|
|
| T |
15676614 |
tggatatatttcgatgaaaaaacgttcacttgagagggaccatattcaaatgaatgaattagctcaaacttaagttgaaaattattagtatatcaagtgt |
15676515 |
T |
|
| Q |
170 |
aagcaagagtctcgcatttgatagcacaatgaattttcaacattatataagtgggatatactcaataccttacaattttatctcaaaatatgatgtttaa |
269 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||| |||||||| |||||| ||| ||||| |||||||||| |
|
|
| T |
15676514 |
aagcaagagtctcgcatttaatagcacaatgaattttcacaattacataagtgggatatactccataccttaaaattttgtcttaaaatgtgatgtttaa |
15676415 |
T |
|
| Q |
270 |
tttcacatatatgattgtttaaagt |
294 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
15676414 |
tttcacatatataattgtttaaagt |
15676390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University