View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14457_low_2 (Length: 234)
Name: NF14457_low_2
Description: NF14457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14457_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 8 - 218
Target Start/End: Complemental strand, 35106322 - 35106116
Alignment:
| Q |
8 |
gatgtttctaacacttctttatatatattgttccctacacaacagcacgcgggcatacacccaaatattattttcgtacaaataacacaaaaattgtcgt |
107 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35106322 |
gatgtttctaacacttctttatat----tgttccctacacaacagcacccgggcatacacccaaatattattttcgtacaaataacacaaaaattgtcgt |
35106227 |
T |
|
| Q |
108 |
ccaacttatgcattatcataattttactctaatgtctcggtcgctaaaatactatgtttttcaccatggaaatgatgttactgcagaaattatgtttgtg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35106226 |
ccaacttatgcattatcataattttactctaatgtctcggtcgctaaaatactatgtttttcaccatggaaatgatgttactgcagaaattatgtttgtg |
35106127 |
T |
|
| Q |
208 |
gaacatatgtc |
218 |
Q |
| |
|
||| ||||||| |
|
|
| T |
35106126 |
gaatatatgtc |
35106116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University