View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14458_high_2 (Length: 259)
Name: NF14458_high_2
Description: NF14458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14458_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 27172431 - 27172195
Alignment:
| Q |
1 |
aaaatatttgtaatagtataatatgagtgcttgcatattcatgaatgcatgcattatttgtctgctgcagatgggcccaaatagcaaagcaccttcctgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27172431 |
aaaatatttgtaatagtataatatgagtgcttgtaaattcatgaatgcatgcattatttgtctgctgcagatgggcccaaatagcaaagcaccttcctgg |
27172332 |
T |
 |
| Q |
101 |
tagaactgataatgaagtgaagaatttttggaactcttgcattaaaaagaagcttatttctcaaggcttagatccacaaactcacaatttactttcgtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27172331 |
tagaactgataatgaagtgaagaatttttggaactcttgcattaaaaagaagcttatttctcaaggcttagatccacaaactcacaatttactttcttct |
27172232 |
T |
 |
| Q |
201 |
tctcatcctaagagaaacaacgcacattataaaagtt |
237 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |
|
|
| T |
27172231 |
tctcatcctaagagaaacaactcaaattataaaagtt |
27172195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University