View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14458_high_5 (Length: 234)
Name: NF14458_high_5
Description: NF14458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14458_high_5 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 21651740 - 21651973
Alignment:
| Q |
1 |
aatgggatcgatacgaatggtcaaagaaagtaatccatattagtgctaggaaacaaaccaaatggtatgnnnnnnncatccctttcccctcgatttttgg |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21651740 |
aatgggatcgatatgaatggtcaaagaaagtaatccatattagtgctaggaaacaaaccaaatggtatgtttttttcatccctttcccctcgatttttgg |
21651839 |
T |
|
| Q |
101 |
ttgacaatgtacaggctgaggtttttcgctcttaaataaaacttgagaattcttgaagcagttcgtcgtatctaagcttttacttcttatactgttttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21651840 |
ttgacaatgtacaggctgaggtttttcgctcttaaataaaacttgagaattcttgaagcagtttgtcatatctaagcttttacttcttatactgttttat |
21651939 |
T |
|
| Q |
201 |
gcaggtggtatgctaaaaggtttttgcatcctga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21651940 |
gcaggtggtatgctaaaaggtttttgcatcctga |
21651973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 40420168 - 40420101
Alignment:
| Q |
1 |
aatgggatcgatacgaatggtcaaagaaagtaatccatattagtgctaggaaacaaaccaaatggtat |
68 |
Q |
| |
|
||||||||| || || ||||||||||| | ||||||| ||||||| ||||||||||| ||||||||| |
|
|
| T |
40420168 |
aatgggatcaatttgagtggtcaaagaatgcaatccatgttagtgcaaggaaacaaacaaaatggtat |
40420101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University