View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14458_high_6 (Length: 229)
Name: NF14458_high_6
Description: NF14458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14458_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 4124477 - 4124279
Alignment:
| Q |
17 |
attttaaaattcacagcagaatgctggcacccgaatattttgagcaaaaagtaatactaaaccaacgtatgttggtattnnnnnnntggctatgcaccca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| || |
|
|
| T |
4124477 |
attttaaaattcacagcagaatgctggcacccgaatattttgagcaaaaagtaatactaaactaacgtatgttggtattaaaaaaatggctatgcactca |
4124378 |
T |
|
| Q |
117 |
cacaaatattttattaccactctcaaggttggtgacacgtcgtacgtgcttgtacttatctttttatgctttatccgcaagttctctataatatctctg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4124377 |
cacaaatattttattaccactctcaaggttggcgacacgtcgtacgtgcttgtacttctctttttatgctttatccgcaagttctctataatatttctg |
4124279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University