View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14458_low_5 (Length: 250)
Name: NF14458_low_5
Description: NF14458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14458_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 44 - 245
Target Start/End: Original strand, 31820290 - 31820495
Alignment:
| Q |
44 |
ttggaactatatatcacctatgct----aactttgtcaaaactacatcttaggtattcaccaagaaaaataactacctcttgaggtggattcttatacaa |
139 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31820290 |
ttggaactatatattacctatgcttgctaactttgtcaaaactacatcttaggtattcaccaagaaaaataactacctcttgaggtggattcttatacaa |
31820389 |
T |
|
| Q |
140 |
tagtataaacttttaatccataaattttatattgaatatttaccaaattttaggtggggaggggacttaacgacccaatgaaatactccccctccactaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31820390 |
tagtataaacttttaatccataaattttatattgaatattgaccaaattttaggtggggaggggacttaatgacccaatgaaatactccccctccactaa |
31820489 |
T |
|
| Q |
240 |
gtagct |
245 |
Q |
| |
|
|||||| |
|
|
| T |
31820490 |
gtagct |
31820495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University