View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14459_high_12 (Length: 295)
Name: NF14459_high_12
Description: NF14459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14459_high_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 289
Target Start/End: Complemental strand, 7175399 - 7175129
Alignment:
| Q |
19 |
atttaagaatttaaaatgtttcatcaaatttgtgggtcaatttttgtctctacgcgatgaatcaacaatattgcatgatttcaaatttcaatgtttgagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175399 |
atttaagaatttaaaatgtttcatcaaatttgtgggtcaatttttgtctctacgcgatgaatcaacaatattgcatgatttcaaatttcaatgtttgagt |
7175300 |
T |
|
| Q |
119 |
gattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatacgttgtttcacataatatcgaaaggattttcgaatatgttgtttcacata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175299 |
gattgggagtgtggcatgcacaaaaagagccaaataaggactttcaaatatgttgtttcacataatatcgaaaggattttcgaatatgttgtttcacata |
7175200 |
T |
|
| Q |
219 |
atgtcaagggattacatatcgacatccaatgtgatatcaactactttccaccaagcttcttttcatctcac |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
7175199 |
atgtcaagggattacatatcgacatccaatgtgatatcaactactttccgccaagcttcttttcatgtcac |
7175129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University