View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14459_high_20 (Length: 204)
Name: NF14459_high_20
Description: NF14459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14459_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 11 - 186
Target Start/End: Complemental strand, 4412068 - 4411893
Alignment:
| Q |
11 |
tagataatacttacggatggaggaaattctgaaacatccaatcacgtagaacggaaacagatctttctggcaagcccctttggggcctccataactgatc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412068 |
tagataatacttacggatggaggaaattctgaaacatccaatcacgtagaacggaaacagatctttctggcaagcccctttggggcctccataactgatc |
4411969 |
T |
|
| Q |
111 |
tttccttttcaactgttgaagagcccattgcttttgaatgaatgaagtttcaacagataattccttatcctcttct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411968 |
tttccttttcaactgttgaagagcccattgcttttgaatgaatgaagtttcaacagataattccttatcctcttct |
4411893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University