View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14459_high_9 (Length: 351)
Name: NF14459_high_9
Description: NF14459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14459_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 195 - 336
Target Start/End: Original strand, 10457500 - 10457640
Alignment:
| Q |
195 |
tttaaccgagggtttaagagnnnnnnnntaataaattgaaagatttatgagttgcagctagcaaggtaaatataggaaaatatacacgttcaggtgttcc |
294 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10457500 |
tttaaccgagggtttaagagaaaaataataataaattgaaagatttatgagttgcagctagcaag-taaatataggaaaatatacacgttcaggtgttcc |
10457598 |
T |
 |
| Q |
295 |
agccatggaagctgaaatacggtagaaggtagcagcagattc |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10457599 |
agccatggaagctgaaatacggtagaaggtagcagcagattc |
10457640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 10457308 - 10457346
Alignment:
| Q |
1 |
attatactagtatgattttagtattattgaatatgtaat |
39 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10457308 |
attatactagtatgtttttagtattattgaatatgtaat |
10457346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 277 - 321
Target Start/End: Complemental strand, 30490735 - 30490691
Alignment:
| Q |
277 |
tacacgttcaggtgttccagccatggaagctgaaatacggtagaa |
321 |
Q |
| |
|
|||| ||||||| || |||||||||||||||||| |||||||||| |
|
|
| T |
30490735 |
tacaagttcaggggtgccagccatggaagctgaagtacggtagaa |
30490691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University