View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14459_low_17 (Length: 257)
Name: NF14459_low_17
Description: NF14459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14459_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 224
Target Start/End: Complemental strand, 36371637 - 36371430
Alignment:
| Q |
17 |
tgtataaggaaatcccttcgagattcgatagtaagaagctgactcaattgcatcagtataagtggagatcactaatgacttttgttcaagtgatggatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36371637 |
tgtataaggaaatcccttcgagattcgatagtaagaagctgactcaattgcatcagtataagtggagatcactaatgacttttgttcaagtgatggatga |
36371538 |
T |
 |
| Q |
117 |
gcaggtgctgaaatactattaatattaatattattattgcttttaatttgtgtattgtttggttttccgataaactctcctatcagactcatgcacctgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36371537 |
gcaggtgctgaaatactattaatattaatattattattgcttttaatttgtgtattgtttggttttccgataaactctcctatcagactcatgcacctgc |
36371438 |
T |
 |
| Q |
217 |
tttggaac |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
36371437 |
tttggaac |
36371430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 126 - 234
Target Start/End: Complemental strand, 36388267 - 36388162
Alignment:
| Q |
126 |
gaaatactattaatattaatattattattgcttttaatttgtgtattgtttggttttccgataaactctcctatcagactcatgcacctgctttggaact |
225 |
Q |
| |
|
|||||||||| || |||||||||||||||| |||||||||||||| ||| ||||||||||||| ||| || ||||| ||||| |||| |||||||| |
|
|
| T |
36388267 |
gaaatactatcaacattaatattattattggttttaatttgtgtactgt---attttccgataaacactcgtaccagacacatgcgtctgcgttggaact |
36388171 |
T |
 |
| Q |
226 |
ttgatactt |
234 |
Q |
| |
|
| ||||||| |
|
|
| T |
36388170 |
tggatactt |
36388162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 126
Target Start/End: Complemental strand, 36388418 - 36388370
Alignment:
| Q |
78 |
gtggagatcactaatgacttttgttcaagtgatggatgagcaggtgctg |
126 |
Q |
| |
|
||||||||| ||||||| | |||||||||||||||||| |||| ||||| |
|
|
| T |
36388418 |
gtggagatccctaatgattgttgttcaagtgatggatgggcagttgctg |
36388370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University