View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14459_low_7 (Length: 392)
Name: NF14459_low_7
Description: NF14459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14459_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 18 - 379
Target Start/End: Original strand, 35804808 - 35805169
Alignment:
| Q |
18 |
aagaatagggatgcaattagaacttgcaacattagatagtcttctcattcctgcttatgcagattcggatgcattgtataacacagattgtattgaaaat |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35804808 |
aagaatagggatgcaattggaacttgcaacattagatagtcttctcattcctgcttatgcagattcggatgcattgtataacacagattgtattgaaaat |
35804907 |
T |
|
| Q |
118 |
attgtccatcattttgtacttacggaatcaaatttaaccgccttttctccttcatcgctagatccacaagcatcatcgtcgtctgaatcgttaaggaaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35804908 |
attgtccatcattttgtacttacggaatcaaatttaaccgccttttctccttcatcgctagatccacaagcatcatcgtcgtctgaatcgttaaggaaag |
35805007 |
T |
|
| Q |
218 |
ttgcgaagttgatagatagctatattggtgaaattgcgtctgatgttaatttaaaaccagaaaagttacgtgctcttgcacaagccctccccgagtcatc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805008 |
ttgcgaagttgatagatagctatattggtgaaattgcgtctgatgttaatttaaaaccagaaaagttacgtgctcttgcacaagccctccccgagtcatc |
35805107 |
T |
|
| Q |
318 |
gagatcattgcatgacggactctaccgagcactagacatatatttcaaggtttgattttcct |
379 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35805108 |
gagatcattgcatgacggactctaccgagcaatagacatatatttcaaggtttgattttcct |
35805169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University