View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14460_high_18 (Length: 288)
Name: NF14460_high_18
Description: NF14460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14460_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 287
Target Start/End: Original strand, 2584907 - 2585179
Alignment:
| Q |
11 |
tatatgttgggttcaagtttaagtaattaatctcacatcgattataattgagttagatatttgatatataagagagatgactaaatatacgatgcttaat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2584907 |
tatatgttgggttcaagtttaagtaattagtctcacatcgattatgaatgagttagatatttgatatataagatagatgactaaatatacgatgcttaat |
2585006 |
T |
|
| Q |
111 |
attttggatgtagatatatggtgccaaagtctctagttggttctagatcttggattgtttgttgctctcgtcactccttcggattttccaattaacaagt |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
2585007 |
attttggatgtagatatatggtaccaaagtctctagttggttctagatcttgggttgtttgttgctctcgtcactccttcagattttcc----aacaagt |
2585102 |
T |
|
| Q |
211 |
ggtattagagtcgtgtttcggcttagtgggagagtgagattgaaccatggtgaaatggatccttatatcgaaaaccc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
2585103 |
ggtattagagtcgtgtttcggcttagtgggagagtgagagtgaaccatggtgaattggttccttatatcgaaaaccc |
2585179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University