View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14460_high_19 (Length: 265)
Name: NF14460_high_19
Description: NF14460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14460_high_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 249
Target Start/End: Original strand, 4142687 - 4142913
Alignment:
| Q |
17 |
aaaatccccactaaaaacaaactcacataaaccacattagcaacaataatcccaaagcatgtatacattgatggtaaaatagaaccaccactagatttca |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
4142687 |
aaaatccccactaaaaccaaactcacataaacaacattagcaacaataatcccaaagcatgtatacattgatggcaaaatagaatcaccaccggatttcg |
4142786 |
T |
|
| Q |
117 |
ctgtatctgaaagagatggagatggagatggtgcaggtgttgggtgttcttgaacgtccacggcaactttcattccatgaaagcagtaacctccaccggt |
216 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4142787 |
ctgtatctgaaagaga------tggagatggtgcaggtgttgggtgttcttgaacgtccacggcaactttcattccgtgaaagcagtaacctccaccggt |
4142880 |
T |
|
| Q |
217 |
gataaagtagtatgtctttgcctccgtcaattg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4142881 |
gataaagtagtatgtctttgcctccgtcaattg |
4142913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University